More docs on the ARB website.
See also index of helppages.
Last update on 25. Nov 2018 .
Main topics:
Related topics:



    This file has been automatically converted from the original documentation for easy use inside the ARB help system. Differences compared with the original documentation are unintentionally caused by the conversion process. In doubt please refer to the original documentation!



    [file has been slightly modified to fit into arb help]


    ReadSeq supported formats (revised 30Dec92)


    -f[ormat=]Name Format name for output:
       |  1. IG/Stanford           10. Olsen (in-only)
       |  2. GenBank/GB            11. Phylip3.2
       |  3. NBRF                  12. Phylip
       |  4. EMBL                  13. Plain/Raw
       |  5. GCG                   14. PIR/CODATA
       |  6. DNAStrider            15. MSF
       |  7. Fitch                 16. ASN.1
       |  8. Pearson/Fasta         17. PAUP
       |  9. Zuker (in-only)       18. Pretty (out-only)

    In general, output supports only minimal subsets of each format needed for sequence data exchanges. Features, descriptions and other format-unique information is discarded.

    Users of Olsen multi sequence editor (VMS). The Olsen format
    here is produced with the print command:
    Use Genbank output from readseq to produce a format that this
    editor can read, and use the command
      load/genbank some.file
    Dan Davison has a VMS program that will convert to/from the
    Olsen native binary data format. E-mail

    Warning: Phylip format input is now supported (30Dec92), however the auto-detection of Phylip format is very probabilistic and messy, especially distinguishing sequential from interleaved versions. It is not recommended that one use readseq to convert files from Phylip format to others unless essential.


    ReadSeq usage (revised 11Nov91)


    1. determine file format:
      short skiplines;  /* result: number of header lines to skip (or 0) */
      short error;      /* error result or 0 */
      short format;     /* resulting format code, see ureadseq.h */
      char  *filename   = "Mysequence.file"
      format = seqFileFormat( filename, &skiplines, &error); if (error!=0) fail;
    2. read number and list of sequences (optional)
      short numseqs;    /* resulting number of sequences found in file */
      char  *seqlist;   /* list of sequence names, newline separated, 0 terminated */
      seqlist = listSeqs( filename, skiplines, format, &numseqs, &error);
      if (error!=0)  display (seqlist);
      free( seqlist);
    3. read individual sequences as desired
      short seqIndex;   /* sequence index #, or == kListSeqs for listSeqs equivalent */
      long  seqlen;     /* length of seq */
      char  seqid[256]; /* sequence name */
      char  *seq;       /* sequence, 0 terminated, free when done */
      seq = readSeq( seqIndex, filename, skiplines, format,
                    &seqlen, &numseqs, &error, seqid);
      if (error!=0) manipulate(seq);
    4. write sequences as desired
      int nlines;     /* number of lines of sequence written */
      FILE* fout;     /* open file pointer (stdout or other) */
      short outform;  /* output format, see ureadseq.h */
      nlines = writeSeq( fout, seq, seqlen, format, outform, seqid);

    Note (30Dec92): There is various processing done by the main program (in readseq.c),
      rather than just in the subroutines (in ureadseq.c). Especially for interleaved
      output formats, the writeSeq subroutine does not handle interleaving, nor some of
      the formatting at the top and end of output files. While seqFileFormat, listSeqs,
      and readSeq subroutines are fairly self-contained, the writeSeq depends a lot on
      auxilliary processing. At some point, this may be revised so writeSeq is
    Note 2: The NCBI toolkit (ftp from is needed for the ASN.1 format
      reading (see ureadasn.c). A bastard (but workable I hope) ASN.1 format is written
      by writeSeq alone.

    sequence formats....


    seq1 info
    efgh1 (or 2 = terminator)
    ;another seq
    seq2 info
    --- for e.g. ----
    ;     Dro5s-T.Seq  Length: 120  April 6, 1989  21:22  Check: 9487  ..
    ;  TOIG of: Dro5srna.Seq  check: 9487  from: 1  to: 120
    LOCUS    seq1 ID..
    ORIGIN ...
    123456789abcdefg....(1st 9 columns are formatting)
    //         (end of sequence)
    LOCUS     seq2 ID ..

    NBRF format: (from uwgcg ToNBRF) >DL;DRO5SRNA Iubio$Dua0:[Gilbertd.Gcg]Dro5srna.Seq;2 => DRO5SRNA



    EMBL format
    ID345 seq1 id   (the 345 are spaces)
    ... other info
    SQ345Sequence   (the 3,4,5 are spaces)
    //              (! this is proper end string: 12Oct90)
    ID    seq2 id
    SQ   Sequence
    UW GCG Format:
    comments of any form, up to ".." signal
    signal line has seq id, and " Check: ####   .."
    only 1 seq/file
    -- e.g. --- (GCG from GenBank)
    LOCUS       DROEST6      1819 bp ss-mRNA            INV       31-AUG-1987
        ... much more ...
    ORIGIN      1 bp upstream of EcoRI site; chromosome BK9 region 69A1.
    INVERTEBRATE:DROEST6  Length: 1819  January 9, 1989  16:48  Check: 8008  ..


    DNAStrider (Mac) = modified Stanford:
    ; ### from DNA Strider  Friday, April 7, 1989   11:04:24 PM
    ; DNA sequence  pBR322   4363  b.p. complete sequence
    //  (end of sequence)
    Fitch format:


    --------------------------------------------------- Phylip version 3.2 format (e.g., DNAML):

       5   13 YF                (# seqs, #bases, YF)
              aaaagggccc... (continued sp. alpha)
              aaaagggccc... (continued sp. beta)
              aaaagggccc... (continued sp. Gamma)
    1234567890^-- bases must start in col 11, and run 'til #bases
            (spaces & newlines are okay)
    Phylip version 3.3 format (e.g., DNAML):
      5    42  YF             (# seqs, #bases, YF)
    1234567890^-- bases must start in col 11
      !! this version interleaves the species -- contrary to
         all other output formats.


    --------------------------------------------------- Phylip version 3.4 format (e.g., DNAML) -- Both Interleaved and sequential are permitted

       5   13                (# seqs, #bases)
              aaaagggccc... (continued sp. alpha)
              aaaagggccc... (continued sp. beta)
              aaaagggccc... (continued sp. Gamma)
    1234567890^-- bases must start in col 11, and run 'til #bases
            (spaces, newlines and numbers are are ignored)

    --------------------------------------------------- Gary Olsen (multiple) sequence editor /print format:

    !17Oct91 -- error in original copy of olsen /print format, shifted right 1 space
    ! here is correct copy:
      301  40 Tb.thiop  CGCAGCGAAA----------GCUNUGCUAAUACCGCAUA-CGnCCUG-----------------------------------------------------  Tb.thiop
      301  42 Rhc.purp  CGUAGCGAAA----------GUUACGCUAAUACCGCAUA-UUCUGUG-----------------------------------------------------  Rhc.purp
      301  44 Rhc.gela  nnngnCGAAA----------GCCGGAUUAAUACCGCAUA-CGACCUA-----------------------------------------------------  Rhc.gela
    RNase P RNA components. on 20-FEB-90 17:23:58
     1 (E.c. pr ):  Base pairing in Escherichia coli RNase P RNA.
     2 (chrom   ):  Chromatium
    12 (B.brevis):  Bacillus brevis RNase P RNA, B. James.
    13 ( 90% con):   90% conserved
    14 (100% con):  100% conserved
    15 (gram+ pr):  pairing
     RNase P RNA components. on 20-FEB-90 17:23:58
    Posi-   Sequence
    tion:   identity:   Data:
         1   1 E.c. pr      <<<<<<<<<< {{{{{{{{<<:<<<<<<<<<<^<<<<<<====>>>>  E.c. pr
         1   2 chrom        GGAGUCGGCCAGACAGUCGCUUCCGUCCU------------------  chrom
         1  12 B.brevis  AUGCAGGAAAUGCGGGUAGCCGCUGCCGCAAUCGUCU-------------  B.brevis
    1234567890123456789012 <! this should be 21 not 22,
    ! this example must be inset on left by 1 space from olsen /print files !
         1  13  90% con           G  C G  A  CGC GC               -    -      90% con
         1  14 100% con                G  A  CGC                             100% con
         1  15 gram+ pr     <<<<<<<<<< {{{{{{{{<<<<<<<<<<<<<===============  gram+ pr
    60   1 E.c. pr   >>>>>>^>>^>>>>:>>    <<<^<<<< {{{{{                 E.c. pr
    60   2 chrom     -----GGUG-ACGGGGGAGGAAAGUCCGG-GCUCCAU-------------  chrom
    :       :
      GCG MSF format
    Title line
    picorna.msf  MSF: 100  Type: P  January 17, 1991  17:53  Check: 541
    Name: Cb3              Len:   100  Check: 7009  Weight:  1.00
    Name: E                Len:   100  Check:   60  Weight:  1.00


       1                                                   50
    Cb3  ...gpvedai .......t.. aaigr..vad tvgtgptnse aipaltaaet
      E  gvenae.kgv tentna.tad fvaqpvylpe .nqt...... kv.affynrs
    51                                                 100
    Cb3  ghtsqvvpgd tmqtrhvkny hsrsestien flcrsacvyf teykn.....
      E  ...spi.gaf tvks...... gs.lesgfap sviltpgpqf
         PIR format
    This is NBRF-PIR MAILSERVER version 1.45
    Command-> get PIR3:A31391
    ENTRY           A31391       #Type Protein
    TITLE           *Esterase-6 - Fruit fly (Drosophila melanogaster)
    DATE            03-Aug-1992 #Sequence 03-Aug-1992 #Text 03-Aug-1992
    PLACEMENT          0.0    0.0    0.0    0.0    0.0
    COMMENT         *This entry is not verified.
    SOURCE          Drosophila melanogaster
       #Authors     Cooke P.H., Oakeshott J.G.
       #Citation    submitted to GenBank, April 1989
       #Reference-number A31391
       #Accession   A31391
       #Cross-reference GB:J04167
    SUMMARY       #Molecular-weight 61125  #Length 544  #Checksum  1679
                    5        10        15        20        25        30
          1 M N Y V G L G L I I V L S C L W L G S N A S D T D D P L L V
         31 Q L P Q G K L R G R D N G S Y Y S Y E S I P Y A E P P T G D
         61 L R F E A P E P Y K Q K W S D I F D A T K T P V A C L Q W D
         91 Q F T P G A N K L V G E E D C L T V S V Y K P K N S K R N S
        121 F P V V A H I H G G A F M F G A A W Q N G H E N V M R E G K
        151 F I L V K I S Y R L G P L G F V S T G D R D L P G N Y G L K
        181 D Q R L A L K W I K Q N I A S F G G E P Q N V L L V G H S A
        211 G G A S V H L Q M L R E D F G Q L A R A A F S F S G N A L D
        241 P W V I Q K G A R G R A F E L G R N V G C E S A E D S T S L
        271 K K C L K S K P A S E L V T A V R K F L I F S Y V P F A P F
        301 S P V L E P S D A P D A I I T Q D P R D V I K S G K F G Q V
        331 P W A V S Y V T E D G G Y N A A L L L K E R K S G I V I D D
        361 L N E R W L E L A P Y L L F Y R D T K T K K D M D D Y S R K
        391 I K Q E Y I G N Q R F D I E S Y S E L Q R L F T D I L F K N
        421 S T Q E S L D L H R K Y G K S P A Y A Y V Y D N P A E K G I
        451 A Q V L A N R T D Y D F G T V H G D D Y F L I F E N F V R D
        481 V E M R P D E Q I I S R N F I N M L A D F A S S D N G S L K
        511 Y G E C D F K D N V G S E K F Q L L A I Y I D G C Q N R Q H
        541 V E F P
    PAUP format:
    The NEXUS Format

    Every block starts with "BEGIN blockname;" and ends with "END;". Each block is composed of one or more statements, each terminated by a semicolon (;).

    Comments may be included in NEXUS files by enclosing them within square brackets, as in "[This is a comment]."

    NEXUS-conforming files are identified by a "#NEXUS" directive at the very beginning of the file (line 1, column 1). If the #NEXUS is omitted PAUP issues a warning but continues processing.

    NEXUS files are entirely free-format. Blanks, tabs, and newlines may be placed anywhere in the file. Unless RESPECTCASE is requested, commands and data may be entered in upper case, lower case, or a mixture of upper and lower case.

    The following conventions are used in the syntax descriptions of the various blocks. Upper-case items are entered exactly as shown. Lower-case items inside of angle brackets -- e.g., <x> -- represent items to be substituted by the user. Items inside of square brackets -- e.g., [X] -- are optional. Items inside of curly braces and separated by vertical bars -- e.g., { X | Y | Z } -- are mutually exclusive options.

    The DATA Block

    The DATA block contains the data matrix and other associated information. Its syntax is:

    DIMENSIONS NTAX=<number of taxa> NCHAR=<number of characters>;
      [ FORMAT  [ MISSING=<missing-symbol> ]
            [ LABELPOS={ LEFT | RIGHT } ]
            [ SYMBOLS="<symbols-list>" ]
            [ INTERLEAVE ]
            [ MATCHCHAR=<match-symbol> ]
            [ EQUATE="<symbol>=<expansion> [<symbol>=<expansion>...]" ]
            [ TRANSPOSE ]
            [ RESPECTCASE ]
            [ DATATYPE = { STANDARD | DNA | RNA | PROTEIN } ]; ]
            [ OPTIONS [ IGNORE={ INVAR | UNINFORM } ]
            [ ZAP = "<list of zapped characters>" ] ; ]
      [ CHARLABELS <label_1> <label_2> <label_NCHAR> ; ]
      [ TAXLABELS <label1_1> <label1_2> <label1_NTAX> ; ]
      [ STATELABELS <currently ignored by PAUP> ; ]
      MATRIX <data-matrix> ;

    --- example PAUP file


    [!Brown et al. (1982) primate mitochondrial DNA]

    begin data;
      dimensions ntax=5 nchar=896;
      format datatype=dna matchchar=. interleave missing='-';
    [                              2                    4                    6            8                    ]
    [         1                    1                    1                    1            1                    ]
    human     aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcctcattactatt ctgcctagcaaactcaaact acgaacgcactcacagtcgc
    chimp     ................a.t. .c.................a ...............t.... ..................t. .t........c.........
    gorilla ....t.....t........a ........a......t.... .................... .......a..c.....c...
    orang cc.....g..t.....t..a .................... .......a..c.....c...
    gibbon .c.................a ......t............. .......a........c...
    [         8                    8                    8                    8            8              8     ]
    [         0                    2                    4                    6            8              9     ]
    [         1                    1                    1                    1            1              6     ]
    human     cttccccacaacaatattca tgtgcctagaccaagaagtt attatctcgaactgacactg agccacaacccaaacaaccc agctctccctaagctt
    chimp     t................... .a................c. ........a.....g..... ...a................ ................
    gorilla .a................c. ........a.g......... .a..............
    orang     ta....a...........t. .a.a..c.....g...cta. .a.....a........
    gibbon    a..t.......t........ .....t..a........... .a..............

    Sample SMTP mail header


    - - - - - - - - -
    From Sun Nov 10 17:28:56 1991
    Received: from by
            (4.1/9.5jsm) id AA19328; Sun, 10 Nov 91 17:28:55 EST
    Received: by (5.65/IG-2.0)
            id AA14458; Sun, 10 Nov 91 14:30:03 -0800
    Date: Sun, 10 Nov 91 14:30:03 -0800
    Message-Id: <>
    From: Database Server <>
    Subject: Results of Query for drorna
    Status: R
    No matches on drorna.
    - - - - - -
    From Sun Nov 10 17:28:49 1991
    Received: from by
            (4.1/9.5jsm) id AA19323; Sun, 10 Nov 91 17:28:47 EST
    Received: by (5.65/IG-2.0)
            id AA14461; Sun, 10 Nov 91 14:30:03 -0800
    Date: Sun, 10 Nov 91 14:30:03 -0800
    Message-Id: <>
    From: Database Server <>
    Subject: Results of Query for droest6
    Status: R
    LOCUS       DROEST6      1819 bp ss-mRNA            INV       31-AUG-1987
    DEFINITION  D.melanogaster esterase-6 mRNA, complete cds.
    ACCESSION   M15961

    GCG manual discussion of sequence symbols:



         GCG programs allow all upper and lower  case  letters,  periods  (.),
    asterisks  (*),  pluses  (+),  ampersands  (&),  and ats (@) as symbols in
    biological sequences. Nucleotide  symbols,  their  complements,  and  the
    standard  one-letter amino acid symbols are shown below in separate lists.
    The meanings of the symbols +, &, and @ have not  been  assigned  at  this
    writing (March, 1989).
         GCG uses the  letter  codes  for  amino  acid  codes  and  nucleotide
    ambiguity    proposed    by    IUB    (Nomenclature    Committee,    1985,
    Eur. J. Biochem. 150; 1-5). These codes are  compatible  with  the  codes
    used by the EMBL, GenBank, and NBRF data libraries.
         The meaning of each symbol, its complement,  and  the  Cambridge  and
    Stanford  equivalents  are  shown below. Cambridge files can be converted
    into GCG files and vice versa with the programs FROMSTADEN  and  TOSTADEN.
    IntelliGenetics  sequence  files  can  be interconverted with the programs
    FROMIG and TOIG.
    IUB/GCG      Meaning     Complement   Staden/Sanger  Stanford
     A             A             T             A            A
     C             C             G             C            C
     G             G             C             G            G
    T/U            T             A             T           T/U
     M           A or C          K             5            J
     R           A or G          Y             R            R
     W           A or T          W             7            L
     S           C or G          S             8            M
     Y           C or T          R             Y            Y
     K           G or T          M             6            K
     V        A or C or G        B       not supported      N
     H        A or C or T        D       not supported      N
     D        A or G or T        H       not supported      N
     B        C or G or T        V       not supported      N
    X/N     G or A or T or C     X            -/X           N
     . not G or A or T or C   . not supported      ?
      The frame ambiguity codes used by Staden are not  supported  by  GCG
    and   are  translated  by  FROMSTADEN  as  the  lower  case  single  base
    Staden Code          Meaning              GCG
    D                C or CC                c
    V                T or TT                t
    B                A or AA                a
    H                G or GG                g
    K                C or CX                c
    L                T or TX                t
    M                A or AX                a
    N                G or GX                g
      Here is a list of the standard one-letter amino acid codes and their
    three-letter  equivalents. The synonymous codons and their depiction in
    the IUB codes are shown. You should recognize that the codons  following
    semicolons  (;)  are  not  sufficiently specific to define a single amino
    acid even though they represent the best possible back  translation  into
    the IUB codes!  All of the relationships in this list can be redefined by
    the user in a local data file described below.
    Symbol 3-letter  Meaning      Codons                Depiction
     A    Ala       Alanine      GCT,GCC,GCA,GCG         !GCX
     B    Asp,Asn   Aspartic,
                    Asparagine   GAT,GAC,AAT,AAC         !RAY
     C    Cys       Cysteine     TGT,TGC                 !TGY
     D    Asp       Aspartic     GAT,GAC                 !GAY
     E    Glu       Glutamic     GAA,GAG                 !GAR
     F    Phe     Phenylalanine  TTT,TTC                 !TTY
     G    Gly       Glycine      GGT,GGC,GGA,GGG         !GGX
     H    His       Histidine    CAT,CAC                 !CAY
     I    Ile       Isoleucine   ATT,ATC,ATA             !ATH
     K    Lys       Lysine       AAA,AAG                 !AAR
     L    Leu       Leucine      TTG,TTA,CTT,CTC,CTA,CTG
     M    Met       Methionine   ATG                     !ATG
     N    Asn       Asparagine   AAT,AAC                 !AAY
     P    Pro       Proline      CCT,CCC,CCA,CCG         !CCX
     Q    Gln       Glutamine    CAA,CAG                 !CAR
     R    Arg       Arginine     CGT,CGC,CGA,CGG,AGA,AGG
     S    Ser       Serine       TCT,TCC,TCA,TCG,AGT,AGC !TCX,AGY;WSX
     T    Thr       Threonine    ACT,ACC,ACA,ACG         !ACX
     V    Val       Valine       GTT,GTC,GTA,GTG         !GTX
     W    Trp       Tryptophan   TGG                     !TGG
     X    Xxx       Unknown                              !XXX
     Y    Tyr       Tyrosine     TAT, TAC                !TAY
     Z    Glu,Gln   Glutamic,
                    Glutamine    GAA,GAG,CAA,CAG         !SAR
     *    End       Terminator   TAA, TAG, TGA           !TAR,TRA;TRR

    docs from PSC on sequence formats:


    Nucleic Acid and Protein Sequence File Formats

    It will probably save you some time if you have your data in a usable format before you send it to us. However, we do have the University of Wisconsin Genetics Computing Group programs running on our VAXen and this package includes several reformatting utilities. Our programs usually recognize any of several standard formats, including GenBank, EMBL, NBRF, and MolGen/Stanford. For the purposes of annotating an analysis we find the GenBank and EMBL formats most useful, particularly if you have already received an accession number from one of these organizations for your sequence.
    Our programs do not require that all of the line types available in GenBank, EMBL, or NBRF file formats be present for the file format to be recognized and processed. The following pages outline the essential details required for correct processing of files by our programs. Additional information may be present but will generally be ignored.

    GenBank File Format

    File Header
    1. The first line in the file must have "GENETIC SEQUENCE DATA BANK" in spaces 20 through 46 (see LINE 1, below).
    2. The next 8 lines may contain arbitrary text. They are ignored but are required to maintain the GenBank format (see LINE 2 - LINE 9).
      Sequence Data Entries
    3. Each sequence entry in the file should have the following format.
      1. first line:
        Must have LOCUS in the first 5 spaces. The genetic locus name or identifier must be in spaces 13 - 22. The length of the sequences is right justified in spaces 23 through 29 (see LINE 10).
      2. second line:
        Must have DEFINITION in the first 10 spaces. Spaces 13 - 80 are free form text to identify the sequence (see LINE 11).
      3. third line:
        Must have ACCESSION in the first 9 spaces. Spaces 13 - 18 must hold the primary accession number (see LINE 12).
      4. fourth line:
        Must have ORIGIN in the first 6 spaces. Nothing else is required on this line, it indicates that the nucleic acid sequence begins on the next line (see LINE 13).
      5. fifth line:
        Begins the nucleotide sequence. The first 9 spaces of each sequence line may either be blank or may contain the position in the sequence of the first nucleotide on the line. The next 66 spaces hold the nucleotide sequence in six blocks of ten nucleotides. Each of the six blocks begins with a blank space followed by ten nucleotides. Thus the first nucleotide is in space eleven of the line while the last is in space 75 (see LINE 14, LINE 15).
      6. last line:
        Must have // in the first 2 spaces to indicate termination of the sequence (see LINE 16).

    NOTE:  Multiple sequences may appear in each file. To begin another
           sequence go back to a) and start again.
    Example GenBank file
    LINE 1  :                   GENETIC SEQUENCE DATA BANK
    LINE 2  :
    LINE 3  :
    LINE 4  :
    LINE 5  :
    LINE 6  :
    LINE 7  :
    LINE 8  :
    LINE 9  :
    LINE 10  :LOCUS       L_Name     Length BP
    LINE 11  :DEFINITION  Describe the sequence any way you want
    LINE 12  :ACCESSION   Accession Number
    LINE 13  :ORIGIN
    LINE 14  :        1 acgtacgtac gtacgtacgt acgtacgtac gtacgtacgt a...
    LINE 15  :       61 acgt...
    LINE 16  ://

    EMBL File Format

    Unlike the GenBank file format the EMBL file format does not require a series of header lines. Thus the first line in the file begins the first sequence entry of the file.
    1. The first line of each sequence entry contains the two letters ID in the first two spaces. This is followed by the EMBL identifier in spaces 6 through 14. (See LINE 1).
    2. The second line of each sequence entry has the two letters AC in the first two spaces. This is followed by the accession number in spaces 6 through 11. (See LINE 2).
    3. The third line of each sequence entry has the two letters DE in the first two spaces. This is followed by a free form text definition in spaces 6 through 72. (See LINE 3).
    4. The fourth line in each sequence entry has the two letters SQ in the first two spaces. This is followed by the length of the sequence beginning at or after space 13. After the sequence length there is a blank space and the two letters BP. (See LINE 4).
    5. The nucleotide sequence begins on the fifth line of the sequence entry. Each line of sequence begins with four blank spaces. The next 66 spaces hold the nucleotide sequence in six blocks of ten nucleotides. Each of the six blocks begins with a blank space followed by ten nucleotides. Thus the first nucleotide is in space 6 of the line while the last is in space 70. (See LINE 5 - LINE 6).
    6. The last line of each sequence entry in the file is a terminator line which has the two characters // in the first two spaces. (See LINE 7).
    7. Multiple sequences may appear in each file. To begin another sequence go back to item 1 and start again.

    Example EMBL file
    LINE 1  :ID   ID_name
    LINE 2  :AC   Accession number
    LINE 3  :DE   Describe the sequence any way you want
    LINE 4  :SQ          Length BP
    LINE 6  :     ACGT...
    LINE 7  ://

    NBRF (protein or nucleic acid) File Format

    1. The first line of each sequence entry begins with a greater than symbol, >. This is immediately followed by the two character sequence type specifier. Space four must contain a semi-colon. Beginning in space five is the sequence name or identification code for the NBRF database. The code is from four to six letters and numbers. (See LINE 1).
      !!!! >> add these to readseq
                Specifier             Sequence type
      P1                protein, complete
      F1                protein, fragment
      DL                DNA, linear
      DC                DNA, circular
      RL                RNA, linear
      RC                RNA, circular
      N1                functional RNA, other than tRNA
      N3                tRNA
    2. The second line of each sequence entry contains two kinds of information. First is the sequence name which is separated from the organism or organelle name by the three character sequence blank space, dash, blank space, " - ". There is no special character marking the beginning of this line. (See LINE 2).
    3. Either the amino acid or nucleic acid sequence begins on line three and can begin in any space, including the first. The sequence is free format and may be interrupted by blanks for ease of reading. Protein sequences man contain special punctuation to indicate various indeterminacies in the sequence. In the NBRF data files all lines may be up to 500 characters long. However some PSC programs currently have a limit of 130 characters per line (including blanks), and BitNet will not accept lines of over eighty characters. (See LINE 3, LINE 4, and LINE 5).
      The last character in the sequence must be an asterisks, *.

    Example NBRF file
    LINE 1  :>P1;CBRT
    LINE 2  :Cytochrome b - Rat mitochondrion (SGC1)
    LINE 3  :M T N I R K S H P L F K I I N H S F I D L P A P S

    MolGen/Stanford File Format

    1. The first line in a sequence file is a comment line. This line begins with a semi-colon in the first space. This line need not be present. If it is present it holds descriptive text. There may be as many comment lines as desired at the first of sequence file. (See LINE 1).
    2. The second line must be present and contains an identifier or name for the sequence in the first ten spaces. (See LINE 2).
    3. The sequence begins on the third line and occupies up to eighty spaces. Spaces may be included in the sequence for ease of reading. The sequence continues for as many line as needed and is terminated with a 1 or 2. 1 indicates a linear sequence while 2 marks a circular sequence. (See LINE 3 and LINE 4).

    Example MolGen/Stanford file
    LINE 1  :;  Describe the sequence any way you want
    LINE 4  :  GCTTA   GG G C T A1

    Phylip file format


    Phylip 3.3 File Format (DNA sequences)

         The input and output formats for PROTPARS and for RESTML are described  in
    their  document  files. In  general  their input formats are similar to those
    described here, except that the one-letter codes for data are specific to those
    programs  and  are  described in those document files. Since the input formats
    for the eight DNA sequence programs apply to  all  eight,  they  are  described
    here. Their  input  formats are standard: the data have A's, G's, C's and T's
    (or U's). The first line of the input file contains the number of species  and
    the  number  of  sites. As  with  the other programs, options information may
    follow this. In the case of DNAML, DNAMLK,  and  DNADIST  an  additional  line
    (described  in  the  document file for these pograms) may follow the first one.
    Following this, each species starts on a new line. The first 10 characters  of
    that  line  are the species name. There then follows the base sequence of that
    species, each character being one of the letters A, B, C, D, G, H, K, M, N,  O,
    R, S, T, U, V, W, X, Y, ?, or - (a period was also previously allowed but it is
    no longer allowed, because it sometimes is used to in aligned sequences to mean
    "the  same  as  the  sequence  above"). Blanks  will  be ignored, and so will
    numerical digits. This allows GENBANK and EMBL sequence  entries  to  be  read
    with minimum editing.
         These characters can be  either  upper  or  lower  case. The  algorithms
    convert  all  input  characters  to upper case (which is how they are treated).
    The characters constitute the IUPAC (IUB) nucleic acid code  plus  some  slight
    extensions. They enable input of nucleic acid sequences taking full account of
    any ambiguities in the sequence.
    The sequences can continue over multiple lines; when this is done the sequences
    must  be  either  in  "interleaved"  format, similar to the output of alignment
    programs, or "sequential" format. These are described  in  the  main  document
    file. In sequential format all of one sequence is given, possibly on multiple
    lines, before the next starts. In interleaved format the  first  part  of  the
    file  should  contain  the first part of each of the sequences, then possibly a
    line containing nothing but a carriage-return character, then the  second  part
    of  each  sequence, and so on. Only the first parts of the sequences should be
    preceded by names. Here is a hypothetical example of interleaved format:
      5    42
    while in sequential format the same sequences would be:
      5    42
    Note, of course, that a portion of a sequence like this:
    is perfectly legal, assuming that the species name  has  gone  before,  and  is
    filled  out  to  full  length  by  blanks. The above digits and blanks will be
    ignored, the sequence being taken as starting at the first base symbol (in this
    case an A).
         The present versions of the programs may sometimes have difficulties  with
    the  blank  lines  between  groups of lines, and if so you might want to retype
    those lines, making sure that they have only a  carriage-return  and  no  blank
    characters on them, or you may perhaps have to eliminate them. The symptoms of
    this problem are that the programs complain that the sequences are not properly
    aligned, and you can find no other cause for this complaint.

    ASN.1 file format


    ASN.1 -- see NCBI toolkit docs, source and examples (

    Example asn.1 sequence file----

    Bioseq-set ::= {
    seq-set {
      seq {
        id { local id 1 } ,                 -- id essential
        descr {  title "Dummy sequence data from nowhere"  } ,  -- optional
        inst {                              -- inst essential
          repr raw ,
          mol dna ,
          length 156 ,
          topology linear ,
          } } ,
            seq {
              id { local id 2 } ,
              descr {  title "Dummy sequence 2 data from somewhere else"  } ,
              inst {
                    repr raw ,
                    mol dna ,
                    length 150 ,
                    topology linear ,
    partial ASN.1 description from toolkit
    Bioseq ::= SEQUENCE {
        id SET OF Seq-id ,            -- equivalent identifiers
        descr Seq-descr OPTIONAL , -- descriptors
        inst Seq-inst ,            -- the sequence data
        annot SET OF Seq-annot OPTIONAL }
    Seq-inst ::= SEQUENCE {            -- the sequence data itself
        repr ENUMERATED {              -- representation class
            not-set (0) ,              -- empty
            virtual (1) ,              -- no seq data
            raw (2) ,                  -- continuous sequence
            seg (3) ,                  -- segmented sequence
            const (4) ,                -- constructed sequence
            ref (5) ,                  -- reference to another sequence
            consen (6) ,               -- consensus sequence or pattern
            map (7) ,                  -- ordered map (genetic, restriction)
            other (255) } ,
        mol ENUMERATED {               -- molecule class in living organism
            not-set (0) ,              --   > cdna = rna
            dna (1) ,
            rna (2) ,
            aa (3) ,
            na (4) ,                   -- just a nucleic acid
            other (255) } ,
        length INTEGER OPTIONAL ,      -- length of sequence in residues
        fuzz Int-fuzz OPTIONAL ,       -- length uncertainty
        topology ENUMERATED {          -- topology of molecule
            not-set (0) ,
            linear (1) ,
            circular (2) ,
            tandem (3) ,               -- some part of tandem repeat
            other (255) } DEFAULT linear ,
        strand ENUMERATED {            -- strandedness in living organism
            not-set (0) ,
            ss (1) ,                   -- single strand
            ds (2) ,                   -- double strand
            mixed (3) ,
            other (255) } OPTIONAL ,   -- default ds for DNA, ss for RNA, pept
        seq-data Seq-data OPTIONAL ,   -- the sequence
        ext Seq-ext OPTIONAL ,         -- extensions for special types
      hist Seq-hist OPTIONAL }       -- sequence history